Ncbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ncbp1em1(IMPC)J |
| Name: |
nuclear cap binding protein subunit 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5788506 |
| Synonyms: |
Ncbp1em1J |
| Gene: |
Ncbp1 Location: Chr4:46138732-46172403 bp, + strand Genetic Position: Chr4, 24.49 cM
|
| Alliance: |
Ncbp1em1(IMPC)J page
|
| IMPC: |
Ncbp1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ncbp1-7919J-M3862 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGTTTTAACTAAGCT, TAGCTTAGTTAAAACAGGAT, TTAATTTCTGAAGTTGTCCT and CAATTACAACCCTAACCCCT, which resulted in a 274 bp deletion beginning at Chromosome 4 positive strand position 46,144,660 bp GATTGGTTAAGAACTACTCT, and ending after TTTGATTAATTTCTGAAGTTG at 46,144,933 bp (GRCm38/mm10). This mutation deletes exon 2 and 185 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 18 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|