Adrb3^em1(IMPC)Krb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adrb3^em1(IMPC)Krb
• Name: adrenergic receptor, beta 3; endonuclease-mediated mutation 1, Korea Research Institute of Bioscience and Biotechnology
• MGI ID: MGI:5784772
• Synonyms: Adrb3^{em1(IMPC)Kmpc}, Adrb3^em1Krb
• Gene: Adrb3 Location: Chr8:27715804-27720833 bp, - strand Genetic Position: Chr8, 15.94 cM, cytoband A2-A4
• Alliance: Adrb3^em1(IMPC)Krb page
• IMPC: Adrb3 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Research Institute of Bioscience and Biotechnology using Cas9 and guides with spacer sequences GGACTCCTCGTAATGCCACC and TAGTCTCGGCGTGCGGGCGA that targeted exon(s) ENSMUSE00000608725.2 ENSMUSE00000708965.2 ENSMUSE00000709724.2. This resulted in deletion(s) of 29 bp (location: Chr8:27718164-27718192; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adrb3 Mutation: 34 strains or lines available

References

• Original: J:233450 Nam K-H, et al., Direct Data Submission for Alleles from the KRIBB Institute. MGI Direct Data Submission. 2016
• All: 4 reference(s)