About   Help   FAQ
Adrb3em1(IMPC)Krb
Endonuclease-mediated Allele Detail
Summary
Symbol: Adrb3em1(IMPC)Krb
Name: adrenergic receptor, beta 3; endonuclease-mediated mutation 1, Korea Research Institute of Bioscience and Biotechnology
MGI ID: MGI:5784772
Synonyms: Adrb3em1(IMPC)Kmpc, Adrb3em1Krb
Gene: Adrb3  Location: Chr8:27715804-27720833 bp, - strand  Genetic Position: Chr8, 15.94 cM, cytoband A2-A4
Alliance: Adrb3em1(IMPC)Krb page
IMPC: Adrb3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Korea Research Institute of Bioscience and Biotechnology using Cas9 and guides with spacer sequences GGACTCCTCGTAATGCCACC and TAGTCTCGGCGTGCGGGCGA that targeted exon(s) ENSMUSE00000608725.2 ENSMUSE00000708965.2 ENSMUSE00000709724.2. This resulted in deletion(s) of 29 bp (location: Chr8:27718164-27718192; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adrb3 Mutation:  34 strains or lines available
References
Original:  J:233450 Nam K-H, et al., Direct Data Submission for Alleles from the KRIBB Institute. MGI Direct Data Submission. 2016;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory