Snapc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snapc2^em1(IMPC)J
• Name: small nuclear RNA activating complex, polypeptide 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784546
• Synonyms: Snapc2^em1J
• Gene: Snapc2 Location: Chr8:4303102-4306220 bp, + strand Genetic Position: Chr8, 1.99 cM
• Alliance: Snapc2^em1(IMPC)J page
• IMPC: Snapc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Snapc2-7778J-F6434 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTTCAGAGCGTGCAG, GTCCATTCTAGGTCTAGCAG, ATACTGTGTTTGTGTTGCGA and GTTGCGAGGGGGTTGTCTGG, which resulted in a 503 bp deletion around exon 4 beginning at Chromosome 8 positive strand position 4,254,919 bp, GGTCCATTCTAGGTCTAGCA, and ending after TACTGTGTTTGTGTTGCGAG at 4,255,421 bp (GRCm38/mm10). This mutation deletes exon 4 and 121 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Snapc2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)