About   Help   FAQ
Tusc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tusc1em1(IMPC)J
Name: tumor suppressor candidate 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784541
Synonyms: Tusc1em1J
Gene: Tusc1  Location: Chr4:93222385-93223748 bp, - strand  Genetic Position: Chr4, 43.25 cM, cytoband C5
Alliance: Tusc1em1(IMPC)J page
IMPC: Tusc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Tusc1-7713J-M6853 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATGATCCGGACGTTCCG, GTTGGTGGCGGGCTCGTCCG, AGCGGGACCGGCAGAACGCG and GGAGCGCTTCGCCGACCTGG, which resulted in a 413 bp deletion in exon 1 beginning at Chromosome 4 negative strand position 93,335,287 bp, GCCGCGCGGGCGGGGCCCGG, and ending after GCCCGCCGGGAGCCATCGAG at 93,334,875 bp (GRCm38/mm10). This mutation deletes 413 bp in exon 1 as well as an additional 3 bp (gtt) in the exon 50 bp after the 413 bp deletion, and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tusc1 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory