Tusc1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tusc1em1(IMPC)J |
| Name: |
tumor suppressor candidate 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5784541 |
| Synonyms: |
Tusc1em1J |
| Gene: |
Tusc1 Location: Chr4:93222385-93223748 bp, - strand Genetic Position: Chr4, 43.25 cM, cytoband C5
|
| Alliance: |
Tusc1em1(IMPC)J page
|
| IMPC: |
Tusc1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Not Specified
|
| |
|
Mutation details: This allele from project Tusc1-7713J-M6853 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATGATCCGGACGTTCCG, GTTGGTGGCGGGCTCGTCCG, AGCGGGACCGGCAGAACGCG and GGAGCGCTTCGCCGACCTGG, which resulted in a 413 bp deletion in exon 1 beginning at Chromosome 4 negative strand position 93,335,287 bp, GCCGCGCGGGCGGGGCCCGG, and ending after GCCCGCCGGGAGCCATCGAG at 93,334,875 bp (GRCm38/mm10). This mutation deletes 413 bp in exon 1 as well as an additional 3 bp (gtt) in the exon 50 bp after the 413 bp deletion, and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 13 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|