About   Help   FAQ
Prpf4bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prpf4bem1(IMPC)J
Name: pre-mRNA processing factor 4B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779705
Synonyms: Prpf4b-, Prpf4bem1J
Gene: Prpf4b  Location: Chr13:35059285-35090047 bp, + strand  Genetic Position: Chr13, 14.21 cM, cytoband A5
Alliance: Prpf4bem1(IMPC)J page
IMPC: Prpf4b gene page
Prpf4bem1(IMPC)J/Prpf4bem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, appearing as early blastocysts/late morulae, but not at E7.5. Mutants fail to hatch from the zona pellucida with apparent cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Prpf4b-7776J-M6407 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTAGACAACTTTGAGCTT, CTTGTTCACTGCACCAAAAC, CCTGATTACCCAGCACTAGA and GTGTAAGCTCTTCTAGTGAC, which resulted in a 310 bp deletion across exon 5 beginning at Chromosome 13 positive strand position 34,889,350 bp, CTGTTTTGGTGCAGTGAACA, and ending after GTAGTGACAGTAACCAGTCA at 34,889,659 bp (GRCm38/mm10). This mutation deletes exon 5 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 522 and early truncation 42 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prpf4b Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory