Prpf4bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Prpf4bem1(IMPC)J |
| Name: |
pre-mRNA processing factor 4B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5779705 |
| Synonyms: |
Prpf4b-, Prpf4bem1J |
| Gene: |
Prpf4b Location: Chr13:35059285-35090047 bp, + strand Genetic Position: Chr13, 14.21 cM, cytoband A5
|
| Alliance: |
Prpf4bem1(IMPC)J page
|
| IMPC: |
Prpf4b gene page |
|
Prpf4bem1(IMPC)J/Prpf4bem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, appearing as early blastocysts/late morulae, but not at E7.5. Mutants fail to hatch from the zona pellucida with apparent cell death.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Prpf4b-7776J-M6407 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTAGACAACTTTGAGCTT, CTTGTTCACTGCACCAAAAC, CCTGATTACCCAGCACTAGA and GTGTAAGCTCTTCTAGTGAC, which resulted in a 310 bp deletion across exon 5 beginning at Chromosome 13 positive strand position 34,889,350 bp, CTGTTTTGGTGCAGTGAACA, and ending after GTAGTGACAGTAACCAGTCA at 34,889,659 bp (GRCm38/mm10). This mutation deletes exon 5 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 522 and early truncation 42 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|