Prpf4b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf4b^em1(IMPC)J
• Name: pre-mRNA processing factor 4B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779705
• Synonyms: Prpf4b^-, Prpf4b^em1J
• Gene: Prpf4b Location: Chr13:35059285-35090047 bp, + strand Genetic Position: Chr13, 14.21 cM, cytoband A5
• Alliance: Prpf4b^em1(IMPC)J page
• IMPC: Prpf4b gene page

Prpf4b^em1(IMPC)J/Prpf4b^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, appearing as early blastocysts/late morulae, but not at E7.5. Mutants fail to hatch from the zona pellucida with apparent cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CATTAGACAACTTTGAGCTT, CCTGATTACCCAGCACTAGA, CTTGTTCACTGCACCAAAAC, and GTGTAAGCTCTTCTAGTGAC that targeted exon(s) ENSMUSE00000117668.2. This resulted in deletion(s) of 310 bp (location: Chr13:35073333-35073642; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prpf4b Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)