Rab22aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rab22aem1(IMPC)J |
| Name: |
RAB22A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5774461 |
| Synonyms: |
Rab22aem1J |
| Gene: |
Rab22a Location: Chr2:173501638-173543975 bp, + strand Genetic Position: Chr2, 97.26 cM
|
| Alliance: |
Rab22aem1(IMPC)J page
|
| IMPC: |
Rab22a gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Rab22a-7696J-M6742 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGCTACAAAGTAGTCTT, TACTTTGTAGCCTAAAGTGG, CGTGGAAAGTCATCGCAAGC and TTCATCAAGTTCAGGACAAC, which resulted in a 218 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 173,661,355 bp, CTTTAGGCTACAAAGTAGTC, and ending after GTTCGTGGAAAGTCATCGCA at 173,661,572 bp (GRCm38/mm10). This mutation deletes exon 2 and 138 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|