About   Help   FAQ
Rab22aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab22aem1(IMPC)J
Name: RAB22A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5774461
Synonyms: Rab22aem1J
Gene: Rab22a  Location: Chr2:173501638-173543975 bp, + strand  Genetic Position: Chr2, 97.26 cM
Alliance: Rab22aem1(IMPC)J page
IMPC: Rab22a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab22a-7696J-M6742 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGCTACAAAGTAGTCTT, TACTTTGTAGCCTAAAGTGG, CGTGGAAAGTCATCGCAAGC and TTCATCAAGTTCAGGACAAC, which resulted in a 218 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 173,661,355 bp, CTTTAGGCTACAAAGTAGTC, and ending after GTTCGTGGAAAGTCATCGCA at 173,661,572 bp (GRCm38/mm10). This mutation deletes exon 2 and 138 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab22a Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory