About   Help   FAQ
Ier2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ier2em1(IMPC)J
Name: immediate early response 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5766772
Synonyms: Ier2em1J
Gene: Ier2  Location: Chr8:85387960-85389481 bp, - strand  Genetic Position: Chr8, 41.02 cM
Alliance: Ier2em1(IMPC)J page
IMPC: Ier2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Ier2-7674J-M6979 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCAGCAGCGATTTGAGCGA, TGAGCATATTGTCGGCCGGG, ACTGCAACTTCGGCTTCCCG and TACCACTCTCGCATGCAGCG, which resulted in a 404 bp deletion and single base (A) insertion in exon 1 beginning at Chromosome 8 negative strand position 84,662,529 bp, GAAGCCGAAGTTGCAGTGGA, and ending after GCCTGCCGCCCGGCCGACAA at 84,662,126 bp (GRCm38/mm10). This mutation results in a change in amino acid sequence after residue 24 and early truncation 42 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ier2 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory