Ier2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ier2^em1(IMPC)J
• Name: immediate early response 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5766772
• Synonyms: Ier2^em1J
• Gene: Ier2 Location: Chr8:85387960-85389481 bp, - strand Genetic Position: Chr8, 41.02 cM
• Alliance: Ier2^em1(IMPC)J page
• IMPC: Ier2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Ier2-7674J-M6979 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCAGCAGCGATTTGAGCGA, TGAGCATATTGTCGGCCGGG, ACTGCAACTTCGGCTTCCCG and TACCACTCTCGCATGCAGCG, which resulted in a 404 bp deletion and single base (A) insertion in exon 1 beginning at Chromosome 8 negative strand position 84,662,529 bp, GAAGCCGAAGTTGCAGTGGA, and ending after GCCTGCCGCCCGGCCGACAA at 84,662,126 bp (GRCm38/mm10). This mutation results in a change in amino acid sequence after residue 24 and early truncation 42 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ier2 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)