About   Help   FAQ
Zfyve1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfyve1em1(IMPC)J
Name: zinc finger, FYVE domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763136
Synonyms: Zfyve1em1J
Gene: Zfyve1  Location: Chr12:83593332-83643996 bp, - strand  Genetic Position: Chr12, 38.76 cM
Alliance: Zfyve1em1(IMPC)J page
IMPC: Zfyve1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfyve1-7570J-M3232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTGACAAGATGAAGGCGT, ACACTGATGAGTCCCAGGCA, TTACGTTTACAGCGAAAGGG and ATAGTAGTCGTGCCTTACAT, which resulted in a 446 bp deletion spanning exon 4 beginning at Chromosome 12 negative strand position 83,569,169 bp, CTTACATAGGTAGAGTTAAAA, and ending after AGGATGCGCACGGCCTACGC at 83,568,724 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 329 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfyve1 Mutation:  165 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory