Zfyve1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfyve1^em1(IMPC)J
• Name: zinc finger, FYVE domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763136
• Synonyms: Zfyve1^em1J
• Gene: Zfyve1 Location: Chr12:83593332-83643996 bp, - strand Genetic Position: Chr12, 38.76 cM
• Alliance: Zfyve1^em1(IMPC)J page
• IMPC: Zfyve1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfyve1-7570J-M3232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTGACAAGATGAAGGCGT, ACACTGATGAGTCCCAGGCA, TTACGTTTACAGCGAAAGGG and ATAGTAGTCGTGCCTTACAT, which resulted in a 446 bp deletion spanning exon 4 beginning at Chromosome 12 negative strand position 83,569,169 bp, CTTACATAGGTAGAGTTAAAA, and ending after AGGATGCGCACGGCCTACGC at 83,568,724 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 329 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfyve1 Mutation: 165 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)