Adamts14em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Adamts14em1(IMPC)J |
| Name: |
ADAM metallopeptidase with thrombospondin type 1 motif 14; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763135 |
| Synonyms: |
Adamts14em1J |
| Gene: |
Adamts14 Location: Chr10:61032891-61109217 bp, - strand Genetic Position: Chr10, 32.16 cM
|
| Alliance: |
Adamts14em1(IMPC)J page
|
| IMPC: |
Adamts14 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Adamts14-7576J-M3885 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATCCCAAATCTATAGG, ATGTACAACAGGAGTAAAAG, CTTTACTATGCACTGTGCAG and GATGGGGGGTCATAGGGTGA, which resulted in a 560 bp deletion spanning exon 2 beginning at Chromosome 10 negative strand position 61,271,347 bp, CACCCTATGACCCCCCATCC, and ending after ACCCAGAGCCCCCTATAGATT at 61,270,788 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 27 and early truncation 47 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|