About   Help   FAQ
Scgb1c1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Scgb1c1em1(IMPC)J
Name: secretoglobin, family 1C, member 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763057
Synonyms: Scgb1c1em1J
Gene: Scgb1c1  Location: Chr7:140425478-140426682 bp, + strand  Genetic Position: Chr7, 86.04 cM
Alliance: Scgb1c1em1(IMPC)J page
IMPC: Scgb1c1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Scgb1c1-7549J-M2473 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGATCCAGTTAGCCCA, CCTTCCCCATCACCACTAGT, GGAAGAACTGCAAACATTCG, and TGCGAGGTCTCCATCTCTGC, which resulted in a 487 bp deletion spanning exon 2 beginning at Chromosome 7 positive strand position 140,845,938 bp, CCCACTAGTGGTGATGGGG, and ending after ACCCCAAAAGAACTACAT at 140846424 bp (GRCm38/mm10). This mutation deletes exon 2 and 287 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 9 bp deletion (ttagcccag) 64 bp before the 487 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and a stop after an additional 47 amino acids. Note the stop is due to read through into the 3-prime untranslated portion of the transcript. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Scgb1c1 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory