Eipr1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eipr1^em1(IMPC)J
• Name: EARP complex and GARP complex interacting protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755665
• Synonyms: Eipr1^-, Tssc1^em1J
• Gene: Eipr1 Location: Chr12:28801802-28917493 bp, + strand Genetic Position: Chr12, 11.26 cM
• Alliance: Eipr1^em1(IMPC)J page
• IMPC: Eipr1 gene page

Eipr1^em1(IMPC)J/Eipr1^em1(IMPC)J mice exhibit embryonic lethality after E7.5 but before E9.5. Embryos form a rudimentary egg-cylinder but no primitive streak or signs of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGATGTCTGTGCTTCAGGGT, AGGACAATCAGCATCTCGGA, GTGTACGGACAGCACCTAGG, and TCATGAGAACTAAGCTGTAG that targeted exon(s) ENSMUSE00000222667.2. This resulted in deletion(s) of 7 bp (location: Chr12:28816636-28816642; GRCm39), 20 bp (location: Chr12:28817053-28817072; GRCm39), and 303 bp (location: Chr12:28816737-28817039; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Eipr1 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)