Eipr1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Eipr1em1(IMPC)J |
| Name: |
EARP complex and GARP complex interacting protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5755665 |
| Synonyms: |
Eipr1-, Tssc1em1J |
| Gene: |
Eipr1 Location: Chr12:28801802-28917493 bp, + strand Genetic Position: Chr12, 11.26 cM
|
| Alliance: |
Eipr1em1(IMPC)J page
|
| IMPC: |
Eipr1 gene page |
|
Eipr1em1(IMPC)J/Eipr1em1(IMPC)J mice exhibit embryonic lethality after E7.5 but before E9.5. Embryos form a rudimentary egg-cylinder but no primitive streak or signs of gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|