About   Help   FAQ
Eipr1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Eipr1em1(IMPC)J
Name: EARP complex and GARP complex interacting protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755665
Synonyms: Eipr1-, Tssc1em1J
Gene: Eipr1  Location: Chr12:28801802-28917493 bp, + strand  Genetic Position: Chr12, 11.26 cM
Alliance: Eipr1em1(IMPC)J page
IMPC: Eipr1 gene page
Eipr1em1(IMPC)J/Eipr1em1(IMPC)J mice exhibit embryonic lethality after E7.5 but before E9.5. Embryos form a rudimentary egg-cylinder but no primitive streak or signs of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Eipr1 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory