Eipr1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eipr1^em1(IMPC)J
• Name: EARP complex and GARP complex interacting protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755665
• Synonyms: Tssc1^em1J
• Gene: Eipr1 Location: Chr12:28801802-28917493 bp, + strand Genetic Position: Chr12, 11.26 cM
• Alliance: Eipr1^em1(IMPC)J page
• IMPC: Eipr1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Eipr1 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)