Stk11ip^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stk11ip^em1(IMPC)J
• Name: serine/threonine kinase 11 interacting protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755625
• Synonyms: LKB1IP^-, Stk11ip^em1J
• Gene: Stk11ip Location: Chr1:75498173-75513979 bp, + strand Genetic Position: Chr1, 39.16 cM, cytoband C3
• Alliance: Stk11ip^em1(IMPC)J page
• IMPC: Stk11ip gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Stk11ip-7486J-M6232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAAGGCTAGGATTTTTGCT, GTGGAATATCTCAAGTACAG, CCTGCCTTCATCACTCCCTA, and AAGGAACATTCAGGTTAGCG, which resulted in a 479 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 75,524,596 bp, GTACAGAGGAGAGTGGGTGC, and ending after CCTGCCTCGCTAACCTGAAT at 75,525,074 bp (GRCm38/mm10). This mutation deletes exon 3 and 273 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 8bp insertion in the intron that will not affect the exon deletion. The 479 bp deletion is predicted to cause a change in amino acid sequence after 20 residues and early truncation 120 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Stk11ip Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)