Stk11ipem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Stk11ipem1(IMPC)J |
| Name: |
serine/threonine kinase 11 interacting protein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5755625 |
| Synonyms: |
LKB1IP-, Stk11ipem1J |
| Gene: |
Stk11ip Location: Chr1:75498173-75513979 bp, + strand Genetic Position: Chr1, 39.16 cM, cytoband C3
|
| Alliance: |
Stk11ipem1(IMPC)J page
|
| IMPC: |
Stk11ip gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project Stk11ip-7486J-M6232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAAGGCTAGGATTTTTGCT, GTGGAATATCTCAAGTACAG, CCTGCCTTCATCACTCCCTA, and AAGGAACATTCAGGTTAGCG, which resulted in a 479 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 75,524,596 bp, GTACAGAGGAGAGTGGGTGC, and ending after CCTGCCTCGCTAACCTGAAT at 75,525,074 bp (GRCm38/mm10). This mutation deletes exon 3 and 273 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 8bp insertion in the intron that will not affect the exon deletion. The 479 bp deletion is predicted to cause a change in amino acid sequence after 20 residues and early truncation 120 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|