About   Help   FAQ
Dctn6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dctn6em1(IMPC)J
Name: dynactin 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755486
Synonyms: Dctn6-, Dctn6em1J
Gene: Dctn6  Location: Chr8:34557574-34575866 bp, - strand  Genetic Position: Chr8, 20.9 cM, cytoband A3
Alliance: Dctn6em1(IMPC)J page
IMPC: Dctn6 gene page
Dctn6em1(IMPC)J/Dctn6em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as normal blastocysts but not at E7.5. Blastocysts grown in culture fail to hatch from the zona pellucida and to form a typical outgrowth colony.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGTGCCAGACCTACAGCCGA, CCTGGGCAGCGGCCGATGTT, GCTCCAAACTGGACGGCACG, and GCTGCACTTCCAGCAGGAGG that targeted exon(s) ENSMUSE00001260487.2. This resulted in deletion(s) of 348 bp (location: Chr8:34564288-34564635; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dctn6 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory