Dctn6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dctn6em1(IMPC)J |
| Name: |
dynactin 6; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5755486 |
| Synonyms: |
Dctn6-, Dctn6em1J |
| Gene: |
Dctn6 Location: Chr8:34557574-34575866 bp, - strand Genetic Position: Chr8, 20.9 cM, cytoband A3
|
| Alliance: |
Dctn6em1(IMPC)J page
|
| IMPC: |
Dctn6 gene page |
|
Dctn6em1(IMPC)J/Dctn6em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as normal blastocysts but not at E7.5. Blastocysts grown in culture fail to hatch from the zona pellucida and to form a typical outgrowth colony.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Dctn6-7440J-F5820 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCAAACTGGACGGCACG, CCTGGGCAGCGGCCGATGTT, AGTGCCAGACCTACAGCCGA, and GCTGCACTTCCAGCAGGAGG, which resulted in a 348 bp deletion spanning exon 4 beginning at Chromosome 8 negative strand position 34,097,481 bp, CTGTAGGTCTGGCACTAACT, and ending after GGAAGGTTTCCCAACATCGG at 34,097,134 bp (GRCm38/mm10). This mutation deletes exon 4 and 259 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 65 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|