About   Help   FAQ
Dctn6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dctn6em1(IMPC)J
Name: dynactin 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755486
Synonyms: Dctn6-, Dctn6em1J
Gene: Dctn6  Location: Chr8:34557574-34575866 bp, - strand  Genetic Position: Chr8, 20.9 cM, cytoband A3
Alliance: Dctn6em1(IMPC)J page
IMPC: Dctn6 gene page
Dctn6em1(IMPC)J/Dctn6em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as normal blastocysts but not at E7.5. Blastocysts grown in culture fail to hatch from the zona pellucida and to form a typical outgrowth colony.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dctn6-7440J-F5820 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCAAACTGGACGGCACG, CCTGGGCAGCGGCCGATGTT, AGTGCCAGACCTACAGCCGA, and GCTGCACTTCCAGCAGGAGG, which resulted in a 348 bp deletion spanning exon 4 beginning at Chromosome 8 negative strand position 34,097,481 bp, CTGTAGGTCTGGCACTAACT, and ending after GGAAGGTTTCCCAACATCGG at 34,097,134 bp (GRCm38/mm10). This mutation deletes exon 4 and 259 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 65 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dctn6 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory