About   Help   FAQ
Ccdc30em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc30em1(IMPC)J
Name: coiled-coil domain containing 30; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755389
Synonyms: Ccdc30em1J
Gene: Ccdc30  Location: Chr4:119179665-119272718 bp, - strand  Genetic Position: Chr4, 55.35 cM, cytoband D1
Alliance: Ccdc30em1(IMPC)J page
IMPC: Ccdc30 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccdc30-7437J-M5774 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATCTGAGAGGATATGCCAA, AGACTACCATTCCGGCTGTG, GCAAGTATGCTCAGGATACG, and CGTGTCAGAGACACGCACAT, which resulted in a 311 bp deletion, spanning ENSMUSE00000449557 (exon 3) beginning at Chromosome 4 negative strand position 119,401,203 bp, GTATCCTGAGCATACTTGCTGT and ending after TCCCCAAGTCTTCAAGAAAT at 119,400,873 bp (GRCm38/mm10), but with 20 bp of intronic sequence, GTGGGGTGATCTGAGAGGAT, retained. This mutation deletes exon 3 and 160 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after residue 55 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc30 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory