Ap2s1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ap2s1em1(IMPC)Tcp |
| Name: |
adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5754583 |
| Synonyms: |
Ap2s1- |
| Gene: |
Ap2s1 Location: Chr7:16472369-16483215 bp, + strand Genetic Position: Chr7, 9.15 cM
|
| Alliance: |
Ap2s1em1(IMPC)Tcp page
|
| IMPC: |
Ap2s1 gene page |
|
Ap2s1em1(IMPC)Tcp/Ap2s1em1(IMPC)Tcp embryos are arrested prior to gastrulation with embryos recovered at E7.5 but not at E9.5. Embryos at E7.5 are smaller, without the presence of head folds, primitive node or primitive streak formation.
Show the 1 phenotype image(s) involving this allele.
|
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was produced in project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GCAAGACGCGCCTGGCCAAG and GATCGAGGAGGTGCACGCCG. This resulted in a 58-bp deletion in chromosome 7 from 16743267 to 16743324 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 18 and early truncation 47 amino acids later (p.K18Pfs*49).
(J:165963, J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
5 reference(s) |
|