About   Help   FAQ
Ap2s1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap2s1em1(IMPC)Tcp
Name: adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754583
Synonyms: Ap2s1-
Gene: Ap2s1  Location: Chr7:16472369-16483215 bp, + strand  Genetic Position: Chr7, 9.15 cM
Alliance: Ap2s1em1(IMPC)Tcp page
IMPC: Ap2s1 gene page
Ap2s1em1(IMPC)Tcp/Ap2s1em1(IMPC)Tcp embryos are arrested prior to gastrulation with embryos recovered at E7.5 but not at E9.5. Embryos at E7.5 are smaller, without the presence of head folds, primitive node or primitive streak formation.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was produced in project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GCAAGACGCGCCTGGCCAAG and GATCGAGGAGGTGCACGCCG. This resulted in a 58-bp deletion in chromosome 7 from 16743267 to 16743324 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 18 and early truncation 47 amino acids later (p.K18Pfs*49). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ap2s1 Mutation:  16 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory