Adnp2^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adnp2^em3(IMPC)Tcp
• Name: ADNP homeobox 2; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:5754578
• Gene: Adnp2 Location: Chr18:80169526-80194697 bp, - strand Genetic Position: Chr18, 53.28 cM
• Alliance: Adnp2^em3(IMPC)Tcp page
• IMPC: Adnp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CATGCTGTAGTACAGAGTGT and CTACTTTGGTTTGCGAACTG. This resulted in an indel comprised of an 8-bp deletion on Chr18 from 80130697 to 80130704 (ENSMUSE00000429049; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 164 and early truncation 14 amino acids later (p.N164V*fs16). (J:165963)

Expression

In Structures Affected by this Mutation:

14 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adnp2 Mutation: 50 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)