Ccdc9b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc9b^em1(IMPC)Tcp
• Name: coiled-coil domain containing 9B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754574
• Gene: Ccdc9b Location: Chr2:118584639-118593142 bp, - strand Genetic Position: Chr2, 59.45 cM
• Alliance: Ccdc9b^em1(IMPC)Tcp page
• IMPC: Ccdc9b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele produced from project TCPR0366 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 38-bp deletion of Chr2 from 118761694 to 118761731 (GRCm38). (J:165963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc9b Mutation: 25 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)