About   Help   FAQ
Neil2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Neil2em1(IMPC)J
Name: nei like 2 (E. coli); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5752781
Synonyms: Neil2em1J
Gene: Neil2  Location: Chr14:63419892-63431305 bp, - strand  Genetic Position: Chr14, 33.24 cM
Alliance: Neil2em1(IMPC)J page
IMPC: Neil2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Neil2-7414J-M375 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCATGCCTTGCCACAGAGG, GACATGTGCAGGGGTCCTAG, GACCCTAAGAGACCTTCACA, and GCCCCTGTGAAGGTCTCTTA, which resulted in a 589 bp deletion spanning exon 3 beginning at Chromosome 14 negative strand position 63,188,250 bp, TGAAGGTCTCTTAGGGTCAA and ending after GCTTAGGTCCTGGAGAGGAG at 63,188,250 bp (GRCm38/mm10). This mutation deletes exon 3 and 248 bp of flanking intronic sequence including the splice acceptor and donor. This deletion is predicted to cause a change in amino acid sequence after residue 46 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Neil2 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory