Neil2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Neil2^em1(IMPC)J
• Name: nei like 2 (E. coli); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5752781
• Synonyms: Neil2^em1J
• Gene: Neil2 Location: Chr14:63419892-63431305 bp, - strand Genetic Position: Chr14, 33.24 cM
• Alliance: Neil2^em1(IMPC)J page
• IMPC: Neil2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Neil2-7414J-M375 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCATGCCTTGCCACAGAGG, GACATGTGCAGGGGTCCTAG, GACCCTAAGAGACCTTCACA, and GCCCCTGTGAAGGTCTCTTA, which resulted in a 589 bp deletion spanning exon 3 beginning at Chromosome 14 negative strand position 63,188,250 bp, TGAAGGTCTCTTAGGGTCAA and ending after GCTTAGGTCCTGGAGAGGAG at 63,188,250 bp (GRCm38/mm10). This mutation deletes exon 3 and 248 bp of flanking intronic sequence including the splice acceptor and donor. This deletion is predicted to cause a change in amino acid sequence after residue 46 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Neil2 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)