Neil2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Neil2em1(IMPC)J |
| Name: |
nei like 2 (E. coli); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5752781 |
| Synonyms: |
Neil2em1J |
| Gene: |
Neil2 Location: Chr14:63419892-63431305 bp, - strand Genetic Position: Chr14, 33.24 cM
|
| Alliance: |
Neil2em1(IMPC)J page
|
| IMPC: |
Neil2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Neil2-7414J-M375 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCATGCCTTGCCACAGAGG, GACATGTGCAGGGGTCCTAG, GACCCTAAGAGACCTTCACA, and GCCCCTGTGAAGGTCTCTTA, which resulted in a 589 bp deletion spanning exon 3 beginning at Chromosome 14 negative strand position 63,188,250 bp, TGAAGGTCTCTTAGGGTCAA and ending after GCTTAGGTCCTGGAGAGGAG at 63,188,250 bp (GRCm38/mm10). This mutation deletes exon 3 and 248 bp of flanking intronic sequence including the splice acceptor and donor. This deletion is predicted to cause a change in amino acid sequence after residue 46 and early truncation 5 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|