About   Help   FAQ
Scamp2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Scamp2em1(IMPC)J
Name: secretory carrier membrane protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5752771
Synonyms: Scamp2em1J
Gene: Scamp2  Location: Chr9:57468226-57496078 bp, + strand  Genetic Position: Chr9, 31.05 cM
Alliance: Scamp2em1(IMPC)J page
IMPC: Scamp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Scamp2-7483J-M6175 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAGCATTAAGGAATACCAT, CCAGCACAGGCACTTCACCC, ACTCTGAACCACCTTCATGG, and CCTGCTCTACCTGGCACAAG, which resulted in a 349 bp deletion spanning ENSMUSE00000259135 (exon 4) beginning at Chromosome 9 positive strand position 57,579,268 bp, GGCACTCCCATGGTATTCCTT and ending after TACTCTGAACCACCTTCATG at 57,579,616 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause a change in amino acid sequence after residue 75 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Scamp2 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory