About   Help   FAQ
Klf14em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Klf14em1(IMPC)H
Name: Kruppel-like transcription factor 14; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:5749945
Gene: Klf14  Location: Chr6:30932956-30935925 bp, - strand  Genetic Position: Chr6, 12.54 cM
Alliance: Klf14em1(IMPC)H page
IMPC: Klf14 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Medical Research Council Harwell using Cas9 and a guide with spacer sequence CGTGCTGCACCGGCGCGCAA that targeted exon(s) ENSMUSE00000655892.5. This resulted in deletion(s) of 5 bp (location: Chr6:30935544-30935548; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Klf14 Mutation:  25 strains or lines available
References
Original:  J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory