Zwint^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zwint^em1(IMPC)J
• Name: ZW10 interactor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749807
• Synonyms: Zwint^em1J
• Gene: Zwint Location: Chr10:72490678-72510796 bp, + strand Genetic Position: Chr10, 37.15 cM
• Alliance: Zwint^em1(IMPC)J page
• IMPC: Zwint gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zwint-7383J-M709 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATAGCCTCTTGAAATAGT, GCGTTTCAGAAGACAGGGGG, CTGTGAACGAGAGCTCTAGA, and CCTTCCCATGAGGCAGACAC, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 72,656,150 bp, AGTGGGCAGCAATGGGGAAGA and ending after GGAAGGAAGGCTGTGAACGAGAGCTC at 72,656,470 bp (GRCm38/mm10). This mutation deletes exon 3 and 197 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 50 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zwint Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)