Zwintem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zwintem1(IMPC)J |
| Name: |
ZW10 interactor; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5749807 |
| Synonyms: |
Zwint-, Zwintem1J |
| Gene: |
Zwint Location: Chr10:72490678-72510796 bp, + strand Genetic Position: Chr10, 37.15 cM
|
| Alliance: |
Zwintem1(IMPC)J page
|
| IMPC: |
Zwint gene page |
|
Zwintem1(IMPC)J/Zwintem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but no embryos at E7.5. Blastocysts grown in vitro hatch from the zona pellucia but the inner cell mass/epiblast cells form a smaller outgrowth colony.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CCTTCCCATGAGGCAGACAC, CTGTGAACGAGAGCTCTAGA, GCGTTTCAGAAGACAGGGGG, and GGATAGCCTCTTGAAATAGT that targeted exon(s) ENSMUSE00001217137.2 ENSMUSE00002026749.1 ENSMUSE00002026771.1. This resulted in deletion(s) of 321 bp (location: Chr10:72491982-72492302; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|