About   Help   FAQ
Zwintem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zwintem1(IMPC)J
Name: ZW10 interactor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749807
Synonyms: Zwint-, Zwintem1J
Gene: Zwint  Location: Chr10:72490678-72510796 bp, + strand  Genetic Position: Chr10, 37.15 cM
Alliance: Zwintem1(IMPC)J page
IMPC: Zwint gene page
Zwintem1(IMPC)J/Zwintem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but no embryos at E7.5. Blastocysts grown in vitro hatch from the zona pellucia but the inner cell mass/epiblast cells form a smaller outgrowth colony.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zwint-7383J-M709 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATAGCCTCTTGAAATAGT, GCGTTTCAGAAGACAGGGGG, CTGTGAACGAGAGCTCTAGA, and CCTTCCCATGAGGCAGACAC, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 72,656,150 bp, AGTGGGCAGCAATGGGGAAGA and ending after GGAAGGAAGGCTGTGAACGAGAGCTC at 72,656,470 bp (GRCm38/mm10). This mutation deletes exon 3 and 197 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 50 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zwint Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory