About   Help   FAQ
Prkxem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prkxem1(IMPC)J
Name: protein kinase, X-linked; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689895
Synonyms: Prkxem1J
Gene: Prkx  Location: ChrX:76805017-76839884 bp, - strand  Genetic Position: ChrX, 38.32 cM
Alliance: Prkxem1(IMPC)J page
IMPC: Prkx gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Prkx-6999J-M3432 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATAACGTTAGGGAGGTGAGG, CTCTTGGGAGAATAACGTTA, TTATCTTTAAGGCCCCAGAT, and ATGGACATCATGCCAATCTG, which resulted in a 283 bp deletion beginning in intron 2 at Chromosome X negative strand position 77,786,367 bp,TTGGCATGATGTCCATTCCTC, and ending after CCACCTCCTCACCTCCCTAA at 77,786,085 bp(GRCm38/mm10) in intron 3. The 283 bp mutation deletes all of exon 2 and is predicted to result in a change of amino acid sequence after amino acid 54 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prkx Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory