Nadk2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nadk2^em1(IMPC)J
• Name: NAD kinase 2, mitochondrial; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5689888
• Synonyms: Nadk2^em1J
• Gene: Nadk2 Location: Chr15:9071340-9110584 bp, + strand Genetic Position: Chr15, 3.82 cM, cytoband A2
• Alliance: Nadk2^em1(IMPC)J page
• IMPC: Nadk2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TTACGGTAAGTCCAAGCGAT and TTGAAAGGCTCGAGCTACAG, which resulted in a 94 bp deletion beginning in exon 2 at Chromosome 15 position 9,083,375 bp, CCATCGCTTGGACTTACCGTA, and ending after GTAGTCCACTGTAGCTCGAGCC at 9,083,282 bp (GRCm38/mm10) in intron 2. This 94 bp deletion begins after the initial 12 bp of coding sequence of exon 2 and includes 77 bp of exon 2 then 17 bp of intron 2 including the splice donor sequence, and is predicted to cause a read-through into intron 2, which results in amino acid sequence changes after amino acid 92 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nadk2 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)