Arr3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arr3^em1(IMPC)J
• Name: arrestin 3, retinal; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688598
• Synonyms: Arr3^em1J
• Gene: Arr3 Location: ChrX:99649103-99662099 bp, + strand Genetic Position: ChrX, 43.72 cM, cytoband C2
• Alliance: Arr3^em1(IMPC)J page
• IMPC: Arr3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arr3-7032J-M2356 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATCCTCATTGCCCTTCCATT, CCATTCTTCAGCATCTCGGT, ATTGGCCTCATAGCTCTGCA, and AGGCCAATTGAAAGGTAGAA, which resulted in a 313 bp deletion beginning in intron 4 at Chromosome X positive strand position 100,606,939 bp at GAATGGAAGGGCAATGAGGATG and ending after GAAAGGAAAGAATCCTTTCAG at 100,607,251 bp (GRCm38/mm10) in intron 5. This mutation results in the deletion of exon4 and is predicted to cause a change in amino acid sequence after residue 13 and early truncation 10 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arr3 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)