Egfem1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Egfem1em1(IMPC)J |
Name: |
EGF-like and EMI domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5662543 |
Synonyms: |
Egfem1em1J |
Gene: |
Egfem1 Location: Chr3:29136172-29745358 bp, + strand Genetic Position: Chr3, 12.57 cM, cytoband A3
|
Alliance: |
Egfem1em1(IMPC)J page
|
IMPC: |
Egfem1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Egfem1-6963J-F4337 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCAGGGTTTGAATTAGAGGG, TGGGAGGTAGACGAATAAGA, GACAAGTTATATGTTACAAG, CTTGTAACATATAACTTGTC, which resulted in a 273bp deletion beginning in intron 3 at Chromosome 3 positive strand position 29,151,713 bp, ATTCGTCTACCTCCCAATGTATGT, and ending after CTTCCTGACAAGTTATATGTTAC at 29,151,985 bp (GRCm38/mm10) in intron 4. This mutation results in the deletion of exon3 and is predicted to cause a change in amino acid sequence after residue 74 and early truncation 35 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|