About   Help   FAQ
Mrpl3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrpl3em1(IMPC)J
Name: mitochondrial ribosomal protein L3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662430
Synonyms: Mrpl3-, Mrpl3em1J
Gene: Mrpl3  Location: Chr9:104930394-104954665 bp, + strand  Genetic Position: Chr9, Syntenic
Alliance: Mrpl3em1(IMPC)J page
IMPC: Mrpl3 gene page
Mrpl3em1(IMPC)J/Mrpl3em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but a primitive streak and hallmarks of gastrulation are not seen at 7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mrpl3-6966J-F0101 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: CACTTCTTATAATAACACGG, ACAAACCACACCATTCCCTG, CAAGCCATACTGTAATTAAG, TTATCTGGAAACAAATAAGC, which resulted in a 355 bp deletion beginning in intron 2 at Chromosome 9 positive strand position 105,054,289 bp, CCCCGTGTTATTATAAGAAGTGT, and ending after GATGTGACCCCTTAATTAC at position 105,054,643 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 45 amino acids later. There is an additional 37 bp deletion in intron 3, downstream of the 355 bp deletion, that is not expected to impact the exon deletion results. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 14 assay results
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mrpl3 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory