About   Help   FAQ
Mrpl44em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrpl44em1(IMPC)J
Name: mitochondrial ribosomal protein L44; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662419
Synonyms: Mrpl44-, Mrpl44em1J
Gene: Mrpl44  Location: Chr1:79753735-79759162 bp, + strand  Genetic Position: Chr1, 40.96 cM
Alliance: Mrpl44em1(IMPC)J page
IMPC: Mrpl44 gene page
Mrpl44em1(IMPC)J/Mrpl44em1(IMPC)J mice exhibit embryonic lethality with embryos recovered at E7.5 but not at E9.5. Embryos are small and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mrpl44-6962J-M4324 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TCTAACAGTCTAAATACAAA, AAGTTAGAGCACACCTTACG, GTTGTACCAAGATCTAGCAA, and ACAGTCTTCATGTGGGCAGA, which resulted in a 604bp deletion beginning in intron 2 at Chromosome 1 positive strand position 79,777,806 bp, CTTACGTGGTACCATGCCCT, and ending after TTTCTCATGCATTCCTTTGC at 79,778,409 bp (GRCm38/mm10) in intron 3. This mutation results in the deletion of exon 2 and is predicted to cause amino acid sequence changes after 60 residues and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 12 assay results
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mrpl44 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory