About   Help   FAQ
Med20em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Med20em1(IMPC)J
Name: mediator complex subunit 20; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5643678
Synonyms: Med20-, Med20em1J
Gene: Med20  Location: Chr17:47922510-47935176 bp, + strand  Genetic Position: Chr17, 23.66 cM
Alliance: Med20em1(IMPC)J page
IMPC: Med20 gene page
Med20em1(IMPC)J/Med20em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Med20-6705J-M5886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGGAACTCTTGGGGACTGAT and GCTTAGAGTATTTACGTTAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 348bp deletion beginning in intron 1 at GGGGACTGATGGGTGGGGAT at Chromosome 17 positive strand position 47,612,827 bp (GRCm38) and ending after GCTTAGAGTATTTACGTTAAT at position 47,613,174 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. RT-PCR analysis confirmed the absence of mRNA expression in homozygous mutant blastocysts. (J:188991, J:286962)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 4 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Med20 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory