About   Help   FAQ
Tmco1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmco1em1(IMPC)J
Name: transmembrane and coiled-coil domains 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5642374
Synonyms: Tmco1em1J
Gene: Tmco1  Location: Chr1:167136239-167161547 bp, + strand  Genetic Position: Chr1, 74.69 cM
Alliance: Tmco1em1(IMPC)J page
IMPC: Tmco1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tmco1-6660J-M1122 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, ATAAGACGAAGTGAATATGT and CAACAATAGAGACCTGTCAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 281bp deletion beginning in intron 3 at TATTCACTTCGTCTTATTGA at Chromosome 1 positive strand position 167,316,119 bp (GRCm38) and ending after AGTTCTTAAAATGTATTACCT at position 167,316,399 bp in intron 4. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmco1 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory