Tmco1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmco1em1(IMPC)J |
| Name: |
transmembrane and coiled-coil domains 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5642374 |
| Synonyms: |
Tmco1em1J |
| Gene: |
Tmco1 Location: Chr1:167136239-167161547 bp, + strand Genetic Position: Chr1, 74.69 cM
|
| Alliance: |
Tmco1em1(IMPC)J page
|
| IMPC: |
Tmco1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tmco1-6660J-M1122 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, ATAAGACGAAGTGAATATGT and CAACAATAGAGACCTGTCAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 281bp deletion beginning in intron 3 at TATTCACTTCGTCTTATTGA at Chromosome 1 positive strand position 167,316,119 bp (GRCm38) and ending after AGTTCTTAAAATGTATTACCT at position 167,316,399 bp in intron 4. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|