Orc6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orc6^em1(IMPC)J
• Name: origin recognition complex, subunit 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5638892
• Synonyms: Orc6^em1J
• Gene: Orc6 Location: Chr8:86026261-86034907 bp, + strand Genetic Position: Chr8, 41.61 cM, cytoband C3
• Alliance: Orc6^em1(IMPC)J page
• IMPC: Orc6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Orc6-6540J-8033M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATCTGTTCAGCAGTAAATG, AACTGCATCCGGTGTGAAAA and TACTAAACCACTTTATTCGC (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 435bp deletion beginning in intron 4 at CTCATTTACTGCTGAACAGATGAA at Chromosome 8 positive strand position 85,305,411 bp (GRCm38) and ending after CTGCGAATAAAGTGGTTTAGTAC at position 85,305,411 bp in intron 5. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 150 and early truncation 6 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Orc6 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)