About   Help   FAQ
Nxnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nxnem1(IMPC)J
Name: nucleoredoxin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5620177
Synonyms: Nxnem1J
Gene: Nxn  Location: Chr11:76148052-76289967 bp, - strand  Genetic Position: Chr11, 45.92 cM
Alliance: Nxnem1(IMPC)J page
IMPC: Nxn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Nxn-6439J-FP22R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GCGTCTAGGAATATTAGCGA, ACTCTGCAATTAATTTGGTT and TGACCCGGAAGGTAAGGCTT which resulted in a 5 bp deletion ATCGC in exon 2 beginning at Chromosome 11 negative strand position 76278553bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 133 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nxn Mutation:  498 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory