About   Help   FAQ
Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh
Targeted Allele Detail
Summary
Symbol: Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh
Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 7.1, Masato Ohtsuka
MGI ID: MGI:5056538
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:173808
Parent Cell Line:  E14TG2a (ES Cell)
Strain of Origin:  129P2/OlaHsd
Mutation
description
Allele Type:    Targeted (Conditional ready, Knockdown, RMCE-ready, Reporter)
Mutation:    Insertion
  Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh involves 1 genes/genome features (Tyr) View all
 
Mutation detailsRecombinase-mediated cassette exchange (RMCE) replaced the expression cassette between the JT15 and lox2272 sites of Gt(ROSA)26Sortm1Maoh with (5' to 3') an IRES, lacZ, polyadenylation sequence, CAG promoter, hygro gene, polyadenylation sequence, FRT site, polyadenylation sequence, and CAG driven fusion of EGFP and a short hairpin RNA targeted to Tyrosinase. The RNAi target sequences within the Tyr gene are "ctggaaggatttgccagtccac"and "gaactgccaatttcagcttta". Flp-mediated recombination removes all but the CAG promoter RNAi construct flanked by an FRT site and the lox2272 site. (J:173808)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1093 strains or lines available
References
Original:  J:173808 Ohtsuka M, et al., Pronuclear injection-based mouse targeted transgenesis for reproducible and highly efficient transgene expression. Nucleic Acids Res. 2010 Dec 1;38(22):e198
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory