Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh
Targeted Allele Detail
|
Symbol: |
Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh |
Name: |
gene trap ROSA 26, Philippe Soriano; targeted mutation 7.1, Masato Ohtsuka |
MGI ID: |
MGI:5056538 |
Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
Alliance: |
Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh page
|
|
Germline Transmission: |
Earliest citation of germline transmission:
J:173808
|
Parent Cell Line: |
E14TG2a (ES Cell)
|
Strain of Origin: |
129P2/OlaHsd
|
|
Allele Type: |
|
Targeted (Conditional ready, Knockdown, RMCE-ready, Reporter) |
Mutation: |
|
Insertion
|
|
|
Gt(ROSA)26Sortm7.1(CAG-EGFP/RNAi:Tyr)Maoh involves 1 genes/genome features (Tyr)
View all
|
|
|
Mutation details: Recombinase-mediated cassette exchange (RMCE) replaced the expression cassette between the JT15 and lox2272 sites of Gt(ROSA)26Sortm1Maoh with (5' to 3') an IRES, lacZ, polyadenylation sequence, CAG promoter, hygro gene, polyadenylation sequence, FRT site, polyadenylation sequence, and CAG driven fusion of EGFP and a short hairpin RNA targeted to Tyrosinase. The RNAi target sequences within the Tyr gene are "ctggaaggatttgccagtccac"and "gaactgccaatttcagcttta". Flp-mediated recombination removes all but the CAG promoter RNAi construct flanked by an FRT site and the lox2272 site.
(J:173808)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Gt(ROSA)26Sor Mutation: |
1022 strains or lines available
|
|
Original: |
J:173808 Ohtsuka M, et al., Pronuclear injection-based mouse targeted transgenesis for reproducible and highly efficient transgene expression. Nucleic Acids Res. 2010 Dec 1;38(22):e198 |
All: |
1 reference(s) |
|