About   Help   FAQ
Antibody
Detail
Antibody
Name: Anti-Celsr1
Host: rabbit
Type: Polyclonal
Note: The antibody was affinity purified.
MGI Accession ID: MGI:5688964
Antigen
Name: Celsr1
Species: Not Specified
Region covered: extracellular domain containing the fourth EGF-like, second laminin-G-like and fifth EGF-like domains. 5'SQRNFCD...VKNECYQG3'
Note: Primers used to amplify the fragment were ExF 5'GCAGGATCCCAGAGGAACTTCTGCGATGG3', ExR 5'GCACTGCAGTCAGACTTTGTTCTCACAGTACTGCCC3'. The amplified fragment was His tagged.
Gene Celsr1  cadherin, EGF LAG seven-pass G-type receptor 1
Expression Gene Expression Data (5 results)
References J:164131 Formstone CJ, et al., Mol Cell Neurosci. 2010 Jul;44(3):210-22
J:163834 Paudyal A, et al., BMC Dev Biol. 2010;10:87
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/23/2024
MGI 6.23 		The Jackson Laboratory