About   Help   FAQ
Comp-pC, Comp-pD Primer Detail
Primers
  • Name
    Comp-pC, Comp-pD
  • Primer 1 Sequence
    CGAGGTCTTGCGTGTGTGCA
  • Primer 2 Sequence
    GGGGACAGTTGTCAGCTACA
  • ID
    MGI:6507709
  • Region Covered
    nucleotides 757-1173
  • Product Size
    397bp
Genes
Comp cartilage oligomeric matrix protein
Expression
  • Assay Results
    22
References
J:63529 Fang C, et al., Molecular cloning, sequencing, and tissue and developmental expression of mouse cartilage oligomeric matrix protein (COMP). J Orthop Res. 2000 Jul;18(4):593-603

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory