About   Help   FAQ
Grhl2-pC, Grhl2-pD Primer Detail
Primers
  • Name
    Grhl2-pC, Grhl2-pD
  • Primer 1 Sequence
    GAAAGCCACAAAGCATCAGGAC
  • Primer 2 Sequence
    AGACAGCACAGCGACATGGAAG
  • ID
    MGI:6155592
Genes
Grhl2 grainyhead like transcription factor 2
Expression
  • Assay Results
    10
References
J:236149 Edwards W, et al., Identification of a novel progenitor cell marker, grainyhead-like 2 in the developing pituitary. Dev Dyn. 2016 Nov;245(11):1097-1106

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory