About   Help   FAQ
Ppp1r9a-pC, Ppp1r9a-pD Primer Detail
Primers
  • Name
    Ppp1r9a-pC, Ppp1r9a-pD
  • Primer 1 Sequence
    GTGCAGGAGGTGTCCCACTG
  • Primer 2 Sequence
    CTGGGATGATGTCATTCCAAG
  • ID
    MGI:5927586
Genes
Ppp1r9a protein phosphatase 1, regulatory subunit 9A
Expression
  • Assay Results
    2
References
J:139777 Monk D, et al., Comparative analysis of human chromosome 7q21 and mouse proximal chromosome 6 reveals a placental-specific imprinted gene, TFPI2/Tfpi2, which requires EHMT2 and EED for allelic-silencing. Genome Res. 2008 Aug;18(8):1270-81

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory