About   Help   FAQ
Mage-l2-pC, Mage-l2-pD Primer Detail
Primers
  • Name
    Mage-l2-pC, Mage-l2-pD
  • Primer 1 Sequence
    CCACACTTACATCATCGTCAACAA
  • Primer 2 Sequence
    AGGCTCAAGACCACCATCAG
  • ID
    MGI:5812498
  • Region Covered
    nucleotides 3719-3823 of GenBank AC156555
Genes
Magel2 MAGE family member L2
Expression
  • Assay Results
    40
Sequences
AC156555 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:237181 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in placenta. MGI Direct Data Submission. 2016;
J:256265 Gordeeva OF, et al., Expression of Cancer-Testis Antigens of the Mage Family in Mouse Oocytes and Early Embryos. Russ J Dev Biol. 2017;48(4):287-294
J:255000 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in brain. MGI Direct Data Submission. 2018;
J:257298 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in heart. MGI Direct Data Submission. 2018;
J:257299 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in liver. MGI Direct Data Submission. 2018;
J:260954 Gordeeva O, Expression Patterns of Cancer-Testis Antigens of Mage Families in Somatic and Reproductive Organs of Immunocompetent and Immunodeficient Mice. MGI Direct Data Submission. 2018;
J:262143 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in male and female gonad. MGI Direct Data Submission. 2018;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
07/26/2022
MGI 6.21
The Jackson Laboratory