About   Help   FAQ
CVprobeGrhl2(0020) Probe Detail
Nucleotide
Probe/Clone
  • Name
    CVprobeGrhl2(0020)
  • Sequence Type
    cDNA
  • ID
    MGI:5508387
  • Region Covered
    3' untranslated region (nucleotides 392 - 1125 of NM_026496.1)
  • Insert Size
    0.733kb
  • Note
    This probe was generated via PCR using the following primer set: TTAGTGCCCATGCCCAGTGACC and TAATACGACTCACTATAGGGAGAGATTTGGTGGCTTCCAGGG. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
  • Synonyms
    GUDMAP:14135 probe, GUDMAP:14136 probe, maprobe:6130
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Sex
    Pooled
  • Tissue
    pelvic urethra and prostate
Genes
Grhl2 grainyhead like transcription factor 2
Expression
  • Assay Results
    118
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:176660 Abler LL, et al., A high-resolution molecular atlas of the fetal mouse lower urogenital tract. Dev Dyn. 2011 Oct;240(10):2364-77

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory