About   Help   FAQ
Ifg-pA, Ifg-pB Primer Detail
Primers
  • Name
    Ifg-pA, Ifg-pB
  • Primer 1 Sequence
    GGTGACCTTGTGACAAGCTC
  • Primer 2 Sequence
    TGCTGTGTGGTCTGTCTGTC
  • ID
    MGI:510
  • Product Size
    239bp
Genes
Ifng interferon gamma
Polymorphisms
J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7
Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.
Endonuclease Gene Allele Fragments Strains
Ifng a 206bp M. spretus
b 232bp SJL
c 234bp NZB
d 241bp BALB/c, DBA/1, DBA/2, NOD, P/J, PL/J
e 243bp C3H/HeJ, CBA, MRL
f 247bp M. m. domesticus
g 239bp AKR, C57BL/6J, M. m. musculus, MRL-Faslpr, NON, NZW, SM, SWR
References
J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/13/2021
MGI 6.16
The Jackson Laboratory