About   Help   FAQ
MTF#1753 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MTF#1753
  • Sequence Type
    cDNA
  • ID
    MGI:4879292
  • Vector Type
    Plasmid
  • Insert Size
    0.716kb
  • Note
    This probe was generated by PCR using the following primer set: CAGAGGCAGGCACTCAAGAAGG and TGCAGGAAGAGGCAAGTGGTCC.
  • Synonyms
    GUDMAP:6548 probe, GUDMAP:6549 probe, maprobe:3297
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL
Genes
Zfp128 zinc finger protein 128
Expression
  • Assay Results
    24
References
J:91257 Gray PA, et al., Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis. Science. 2004 Dec 24;306(5705):2255-2257
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory