About   Help   FAQ
Ppp1r9a-pA, Ppp1r9a-pB Primer Detail
Primers
  • Name
    Ppp1r9a-pA, Ppp1r9a-pB
  • Primer 1 Sequence
    ACCAGGACAAGTGAGTGAGG
  • Primer 2 Sequence
    TCATCGTCGTCAGCATCATAC
  • ID
    MGI:4878831
Genes
Ppp1r9a protein phosphatase 1, regulatory subunit 9A
Expression
  • Assay Results
    15
References
J:161712 Zaitoun I, et al., Upregulation of imprinted genes in mice: an insight into the intensity of gene expression and the evolution of genomic imprinting. Epigenetics. 2010 Feb;5(2):149-58

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory