About   Help   FAQ
T32007 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T32007
  • Sequence Type
    cDNA
  • ID
    MGI:4417265
  • Parent Clone
  • Note
    This probe was generated by PCR using primers MGI:5307615. Template sequence provided by Eurexpress:
    AGGCAGCTGGCGAGTCTAACCTCAAGAGAGTCACCCTGGAGCTGGGTGGGAAGAGCCCCA
    GCATTGTGCTGGCAGACGCTGACATGGAGCATGCCGTAGATCAGTGTCACGAAGCCCTTT
    TCTTCAACATGGGCCAGTGCTGCTGTGCAGGCTCCCGGACATTCGTGGAAGAGTCCATCT
    ACCGTGAGTTTCTCGAGAGAACTGTGGAGAAGGCCAAGCAGAGGAAAGTGGGGAACCCCT
    TTGAGTTGGACACCCAGCAGGGACCTCAGGTGGACAAGGAGCAGTTTGAACGAATCCTGG
    GCTACATCCGGCTGGGACAGAAGGAAGGGGCAAAGCTTCTCTGTGGCGGGGAGCGTTTGG
    GGGAGCGCGGCTTCTTCATCAAACCCACAGTCTTCGGGGACGTTCAGGATGGCATGAGGA
    TCGCCAAGGAGGAGATCTTTGGGCCCGTGCAGCCTCTGTTCAAGTTCAAGAAGATCGAGG
    AAGTAATCCAGAGAGCCAACAACACCAGGTATGGCCTGGCTGCGGCTGTGTTCACCCGAG
    ACCTGGACAAGGCCATCTACTTCACGCAGGCCCTGCAAGCTGGGACGGTGTGGGTGAACA
    CCTATAACATTGTCACCTGCCACACGCCATTCGGAGGCTTTAAGGAATCTGGCAATGGCA
    GGGAGCTGGGGGAGGACGGGCTCAGAGCCTACACGGAGGTGAAGACTGTCACCATCAAGG
    TTCCCGAGAAGAATTCCTGAGATTGGCCATCTTGGAGGCCCAGCCCTGTCCTGCAGCTCC
    GTGACATCTAGCCAGTGGAGGGCAAAATCTGATTTCAGCCTGAGTTCCCAGTGAAGTGTT
    ACAAGAAGTGTCAACCAATAAAGTAGTCCAGCCAGAGCTTTTCTACTTAAAGCAGAGACG
    GTGGCTGGGCCCAGAGTGCAGCCCATTTCATC
  • Synonyms
    EH3923 probe 3867
Source
  • Library
    NCI_CGAP_Co24 (J:91912)
  • Species
    mouse, laboratory
  • Strain
    FVB/N
  • Age
    postnatal month 5
  • Sex
    Male
  • Tissue
    colon
Genes
Aldh1b1 aldehyde dehydrogenase 1 family, member B1
Expression
  • Assay Results
    111
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:139177 Hoffman BG, et al., Identification of transcripts with enriched expression in the developing and adult pancreas. Genome Biol. 2008;9(6):R99
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory