About   Help   FAQ
EN1555 probe 1432 Probe Detail
Nucleotide
Probe/Clone
  • Name
    EN1555 probe 1432
  • Sequence Type
    cDNA
  • ID
    MGI:3821236
  • Note
    This probe was generated by PCR using the following primer set: AACCACAGAGCACATACGTCAG and GCGATTTAGGTGACACTATAGAAGCTACCAGGAGCTGAGCTGT. These primers contain adaptor sequence. Template sequence provided by GenePaint:
    AACCACAGAGCACATACGTCAGGAACTGGCGGTCTTCTGTTCCCCAGAGCCACCTGCCAA
    GACCTCTACCCCTGAAGACTTCATCCGAATGACCAAGGGTATTACTATGGCAACAGCCAA
    AGCCGTTGCTGCTGGCAATTCCTGTCGACAGGAAGATGTCATTGCCACAGCCAATCTGAG
    CCGACGGGCTATTGCGGACATGCTTCGGGCTTGCAAGGAAGCAGCTTTCCACCCAGAAGT
    GGCGCCTGATGTACGGCTCCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGTTACCT
    GGAACTGCTGGACCACGTGCTGCTGACCCTTCAGAAGCCAAACCCAGACCTGAAGCAGCA
    GCTAACTGGACACTCAAAGCGGGTTGCTGGCTCTGTGACTGAGCTCATCCAGGCTGCTGA
    AGCCATGAAAGGAACAGAGTGGGTGGACCCAGAGGACCCTACTGTCATTGCTGAGAATGA
    GCTCTTGGGAGCCGCAGCCGCCATCGAGGCTGCAGCCAAGAAGCTGGAGCAGCTGAAGCC
    CAGGGCCAAACCCAAGGAGGCGGATGAGTCCTTGAACTTTGAGGAACAAATCCTAGAAGC
    TGCCAAGTCCATCGCTGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCAGCAGCCCAGAG
    GGAGCTGGTGGCTCAAGGAAAGGTGGGCGCCATTCCAGCCAATGCACTGGATGATGGGCA
    GTGGTCGCAGGGCCTCATTTCCGCTGCCCGTATGGTGGCTGCGGCCACCAACAATCTGTG
    TGAAGCAGCTAACGCAGCTGTCCAGGGCCATGCTAGCCAGGAGAAACTCATTTCCTCAGC
    CAAGCAAGTAGCTGCCTCCACAGCTCAGCTCCTGGTAGCTTGCAAGGTCAAAGCAGATCA
    GGACTCTGAG
  • Synonyms
    T37140
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal
  • Tissue
    brain
Genes
Tln1 talin 1
Expression
  • Assay Results
    203
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:139177 Hoffman BG, et al., Identification of transcripts with enriched expression in the developing and adult pancreas. Genome Biol. 2008;9(6):R99
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory