About   Help   FAQ
St8sia4-pA, St8sia4-pB Primer Detail
Primers
  • Name
    St8sia4-pA, St8sia4-pB
  • Primer 1 Sequence
    TGTCGGTGAAAGCACAAGTGTT
  • Primer 2 Sequence
    CATCCTTCCTTTCCACAGATGG
  • ID
    MGI:3784258
Genes
St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Expression
  • Assay Results
    2
References
J:130227 Millien G, et al., Characterization of the mid-foregut transcriptome identifies genes regulated during lung bud induction. Gene Expr Patterns. 2008 Jan;8(2):124-39

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory