About   Help   FAQ
MH1494 probe 1200 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MH1494 probe 1200
  • Sequence Type
    cDNA
  • ID
    MGI:3724900
  • Note
    Probe was amplified by RT-PCR (see MGI:3724157 for primer sequences). Template sequence provided by GenePaint:
    AACAACAAGACATAAAGTGCTTATTATGGAGTTTTGTCCCTGTGGGAGTTTATACACTGT
    TCTAGAGGAGCCGTCCAATGCGTATGGACTTCCAGAATCAGAATTTCTCATTGTCTTACG
    AGATGTGGTGGGCGGGATGAATCATCTCCGAGAGAACGGCATAGTGCACCGAGATATCAA
    GCCAGGCAACATCATGCGCGTCATAGGGGAGGACGGCCAGTCTGTGTACAAACTCACGGA
    TTTCGGCGCCGCTCGAGAGCTGGAGGACGATGAGCAGTTTGTGTCTCTGTACGGCACAGA
    AGAGTACCTGCATCCGGACATGTATGAAAGGGCAGTGCTAAGAAAGGACCATCAGAAGAA
    GTACGGGGCTACCGTTGATCTGTGGAGTGTTGGAGTGACATTCTACCATGCAGCCACGGG
    GTCGCTGCCGTTTAGACCCTTCGAGGGGCCTCGGAGGAACAAAGAAGTAATGTATAAAAT
    AATCACTGGGAAGCCGTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAACGGACCAAT
    TGACTGGAGTGGAGACATGCCTCTCTCCTGTAGTCTTTCTCAGGGTCTTCAGGCACTGCT
    TACCCCAGTTCTTGCAAACATACTTGAAGCTGATCAGGAGAAGTGCTGGGGTTTTGACCA
    GTTCTTTGCAGAGACCAGTGATGTGCTTCACCGAATGGTGATCCATGTCTTCTCGCTACA
    ACACATGACGGCGCATAAGATTTACATTCACAGCTATAACACTGCTGCTGTGTTCCATGA
    ACTGGTCTATAAACAAACCAAGATTGTTTCCTCAAATCAAGAACTTATCTACGAAGGACG
    ACGCTTAGTCCTAGAACTCGGACGACTAGCCCAGCATTTTCCTAAAACCACAGAGGAAAA
    TCCTATCTTTGTCACGAGCCGGGAACAACTCAATACCGTAGGACTGAGATATGAAAAAAT
    TTCCCTCCCTAAAATACATCCACGCTATGATCTGGA
  • Synonyms
    T51108
Source
  • Species
    mouse, laboratory
Genes
Tbk1 TANK-binding kinase 1
Expression
  • Assay Results
    94
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:139177 Hoffman BG, et al., Identification of transcripts with enriched expression in the developing and adult pancreas. Genome Biol. 2008;9(6):R99
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory