About   Help   FAQ
mNeat1NP1F, mNeat1NP1R Primer Detail
Primers
  • Name
    mNeat1NP1F, mNeat1NP1R
  • Primer 1 Sequence
    CAGGGTGTCCTCCACCTTTA
  • Primer 2 Sequence
    AAACCAGCAGACCCCTTTTT
  • ID
    MGI:3712075
Genes
Neat1 nuclear paraspeckle assembly transcript 1 (non-protein coding)
References
J:119756 Hutchinson JN, et al., A screen for nuclear transcripts identifies two linked noncoding RNAs associated with SC35 splicing domains. BMC Genomics. 2007;8:39

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory