About   Help   FAQ
Actbc-pA, Actbc-pB Primer Detail
Primers
  • Name
    Actbc-pA, Actbc-pB
  • Primer 1 Sequence
    GACTGCCTACCACAAGCAATGTC
  • Primer 2 Sequence
    CCAGATTTGAGAGATGAGCCTTTC
  • ID
    MGI:3653941
Genes
Inhbc inhibin beta-C
Expression
  • Assay Results
    2
References
J:108109 Oxburgh L, et al., TGFbeta superfamily signals are required for morphogenesis of the kidney mesenchyme progenitor population. Development. 2004 Sep;131(18):4593-605

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory