About   Help   FAQ
MTF#2018 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MTF#2018
  • Sequence Type
    cDNA
  • ID
    MGI:3507402
  • Note
    Template sequence provided by Paul Gray:
    GNTGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGTCAAACTCCCA
    GAGTCCTGCCATGGAAATACCCCCACTCTCTTTCTACAACACAACTCTGGACCTTTCCCA
    GAAAGAAGCTGTGTCCTTTGCACTGGCCCAGAAAGAACTTGCCATCATCCATGGGCCTCC
    TGGCACTGGGAAAACCACAACTGTGGTGGAAATAATCCTTCAAGCTGTGAAGCAAGGCTT
    AAAGGTCCTGTGCTGTGCTCCCTCCAACATCGCTGTGGACAACCTGGTGGAGCGTCTGGC
    TCTGTGCAAGAAGCGGATTCTGCGCCTGGGTCACCCCGCCCGCCTCCTGGAGTCCGTTCA
    GCACCACTCACTGGATGCAGTGCTAGCACGCAGTGACAACGCCCAGATTGTTGCTGACAT
    CAGAAGGGACATAGACCAGGTCTTTGGCAAGAACAAAAAGACGCAGGATAAGAGAGAGAA
    AGGTAATTTTCGAAGTGAAATTAAGCTGCTAAGGAAGGAACTGAAGGAGAGGGAAGAAGC
    AGCCATAGTTCAGAGCCTCACTGCGGCAGATGTGGTTCTAGCCACCAACACANGTGCATC
    GTCTGATGGCCCTCTGAAGCTGCTGCCTGANGACTACTTTGATGTGGTGGTGTGGACGAA
    TGTGCCCAGGCCCTATTGCCTCCGCTGGATCTAAGCCGAATCCAGCACACTGGCGGCCGT
    TACTAGTGGATCCCNAGCTCGGTACCNAGCTTGATGCATAGCTTGAGTATTCTATAGTGT
    CACCTAAATAGCTTGGCGTAATCATGGNCATAGCTGTTTCCTGTGTGAATTGNTATCCGC
    TCNAATTCCACNCAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCNTATGA
    GNGAGCTAACTCCATTNATTGNGNTGCCCCCNTGNCCGCTTTCAGTCGGGAAACTNNCTG
    GCNNCTGCTTTATGATCCGCCACCCGNGGGGAAGNGGTTGGTTTNGGGNCTTNCCC
  • Synonyms
    GUDMAP:6758 probe, maprobe:1279
Source
  • Species
    mouse, laboratory
Genes
Ighmbp2 immunoglobulin mu binding protein 2
Expression
  • Assay Results
    29
References
J:91257 Gray PA, et al., Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis. Science. 2004 Dec 24;306(5705):2255-2257
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory