About   Help   FAQ
MTF#1538 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MTF#1538
  • Sequence Type
    cDNA
  • ID
    MGI:3506964
  • Vector Type
    Plasmid
  • Insert Size
    0.68kb
  • Note
    Fragment was generated by PCR with primers GAAAGCAAGGAGAAGGTCTCGC and TGTTGTAGAAAGCTCGGCCAGG. Template sequence provided by Paul Gray:
    GCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGAAAGCAAGGAGAAGGTCTCG
    CAGCTTGACATACAGATTAAAGCCAAAACTGAATTATTACTATCAGCAGAAGCAGCAAAA
    GCTGCTCAGAGAGCTGATCTTCAGAATCACTTGGACACAGCTCAACATGCGTTACAGGAT
    AAACAACAGGAGTTAAATAAGGTCAGTGTGCAGTTGGATCAGCTCACTGCAAAGTTTCAG
    GAGAAGCAGGAGCATTGCATTCAGCTGGAAAGCCACCTTAAGGATCACAAGGAGAAGCAC
    CTCTCTTTTAGAACAAAAAGTTGAAGACTTAGAAGGCCACATTAAGAAACTAGAAGCTGA
    TGCTCTTGAAGTTAAAGCCAGCAAGGAACAGGCTTTGCAGAGTCTACAGCAGCAGAGGCA
    GCTGAGCACAGACCTGGAGTTGAGAAATGCAGAGCTGAGTAGAGAGCTCCAGGAGCAGGA
    GGAAGTAGTATCTTGTACAAAACTGGATCTACAGAATAAATCTGAAATCCTTGAAAATAT
    CAAACAAACCCTCACCAAGAAAGAAGAAGAAAATGTCGTCTTGAAACAAGAATTTGAAAA
    GTTAAGTCAAGATTCAAAGACACAGCACAAGGAGCTGGGGGACAGGATGCAAGCTGCGGT
    CACAGAGCTGACAGCAGTGAAGGCACAGAAGGACGCACTCCNTGGCCGAGCTTTCTACAA
    CAAAGCCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGC
    TTGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCA
    TAGCTGTTTCCTGTGTGAAATTGNTATCCGCTCCNANTNCNCACAACATACGAGCCGGAA
    GCANAAGTGTAAAGCCTGGGGNGCCTAATGAGTGAGCTAACTCACTTTATTGCGNTGNGC
    TACTGGCCGCTTTCAGTCGGGAAACTGNCGNGCNGCTGCTTTATGA
  • Synonyms
    GUDMAP:6362 probe, GUDMAP:11883 probe, GUDMAP:11976 probe, GUDMAP:13885 probe, maprobe:1007
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL
  • Age
    embryonic day 13.5
  • Tissue
    brain
Genes
Eea1 early endosome antigen 1
Expression
  • Assay Results
    64
References
J:91257 Gray PA, et al., Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis. Science. 2004 Dec 24;306(5705):2255-2257
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:190636 Wiese CB, et al., A genome-wide screen to identify transcription factors expressed in pelvic ganglia of the lower urinary tract. Front Neurosci. 2012;6:130

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory