About   Help   FAQ
MTF#1416 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MTF#1416
  • Sequence Type
    cDNA
  • ID
    MGI:3506902
  • Region Covered
    Nucleotides 271-931 of GenBank Accession ID BC005613.
  • Vector Type
    Plasmid
  • Insert Size
    0.660kb
  • Note
    The source of the material used to create this cDNA probe was different than that used to create the GenBank sequence record. Fragment was generated by PCR with primers TTCCTGCTCATGATGCTCAGG and GAAGACATCATCTGCTCTTGGC. Template sequence provided by Paul Gray:
    GGCCGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGAAGACATCATCTGCTCTTGGCA
    CATAGTTTAATATGTAAGTGTAGGATTATTGTTCTCACAGCATATAATTATGCTAGCCAA
    TAAATACTTACACATCCACTTCAGTTGCATGGGTTGAAGAAAATACAGTAGGATGAGCTG
    GAGCGCCTAATTAACTCTTGCTTTCCTAAGTTAGAATAATTGAAAAGAATAGACTAGACT
    ATGCTTTGATTCGAGAATGGAATAGGCACAAAGCACATAGACTTCAATGTAATTATGAAA
    CTATGTATCTTAGAGGTCGTACTAGTTATTACTTTAACCTCATGAAAGTTTTCCTTTTTA
    ATGGGAAACTGATTCTTAAGGAACAATTTTACTTATACCTTCCTGCTTTTTTTTTATTCA
    ACAGTAAAACAATTAAAATACATACATACATACATACATACATACATACATACATACATA
    CATACCAAAGACTTTAATCTGATTATAAAATACATAATGAAACAGAAGTCTAAGCTTTGG
    GTACACCTATACTCACATAGTAGTAAAAAATGACTACCATTTACTGGCTAAGTCTTGGCT
    TCTCTGCCCATGAAAACCAGTATACTATCTATATCTCAGAAGTAAGATGCATATACCCTA
    GTCACGTGAGAAAACGCGTGCCTGAGCATCATGAGCAGGAAAAGCCGAATTCCAGCACAC
    TGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGATGCATAGCTTGAGTATT
    CTATAGTGNCACCTAAATAGCTTGGCGTAATCATGGGCCATAGCTGNTTCCTGTGGGAAA
    NTGTTATCCGGCTCANANTTCCCACAACATACGAGCCNGGANGCATAANNGNTAAGNCCN
    GGGGGCCCTAAGGGGGGGCTAACTCCCATTAATNGGGNTGCNCTCNTGGCCGCTTTNCAG
    TCGGGAAACTGTNCGGNCCCCTGC
  • Synonyms
    GUDMAP:6261 probe, maprobe:903
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL
  • Age
    embryonic day 13.5
  • Tissue
    brain
Genes
Lpp LIM domain containing preferred translocation partner in lipoma
Expression
  • Assay Results
    28
Sequences
BC005613 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:91257 Gray PA, et al., Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis. Science. 2004 Dec 24;306(5705):2255-2257
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory